Skip to main content

Table 1 Primer sequence of the marker genes

From: Radiation-induced muscle fibrosis rat model: establishment and valuation

Gene name Upstream primers Downstream primers
GAPDH AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA
PAX7 GAGTATAAGAGGGAGAACCCCG TTGATTCTGAGCACTCGGCTAA
MyoD GCTCTGATGGCATGATGGATTAC CTATGCTGGACAGGCAGTCG
MyoG ACTACCTTCCTGTCCACCTTCA AGGCCTCATTCACTTTCTTGAG
Mrf4 ACAGCTACAAACCCAAGCAAGA CTTGCTCCTCCTTCCTTAGCAG
Myf5 TCTGATGGCATGCCTGAATGTAA AAGGAGCTCTTATCTGAAGCACA