Skip to main content

Table 1 Primer sequences and GenBank® accession numbersa of examined genes

From: An expression analysis of markers of radiation-induced skin fibrosis and angiogenesis in wound healing disorders of the head and neck

Gene Accession no. Sequence 5´to 3   Efficiency in %b
Human procollagen alpha 1 (α-PC) NC_000077.6 Forward CTCGAGGTGGACACCACCCT 104.437
   Reverse CAGCTGGATGGCCACATCGG  
Tumor growth factor beta 1 (TGF-β1) NC_010448.3 Forward TGGCGATACCTCAGCAACC 95.488
   Reverse CTCGTGGATCCACTTCCAG  
Human von Willebrand Factor (vWF) NM_000552 Forward GTGACGTGTAATGGGAGACT 95.374
   Reverse GTCATTGGCTCCGTTCTCAT  
GAPDH NG_007073.2 Forward GAGTCAACGGATTTGGTCGT 96.783
   Reverse TTGATTTTGGAGGGATCTCG  
  1. aGenBank® is the National Institutes of Health (NIH, USA) genetic sequence database, an annotated collection of all publicly available DNA sequences [38]
  2. bχ=-1+10(-1/slope)