Skip to main content

Advertisement

Table 1 Primer sequences for RT-PCR and real-time PCR analysis

From: Amelioration of radiation-induced skin injury by adenovirus-mediated heme oxygenase-1 (HO-1) overexpression in rats

Gene Forward primer Reverse primer Product size (bp)
β-Actin 5'- CCCATCTATGAGGGTTACGC -3' 5'- TTTAATGTCACGCACGATTTC -3' 150
endogenous HO-1 5'-CAGAAGGGTCAGGTGTCCAG-3' 5'- GAAGGCCATGTCCTGCTCTA -3' 262
SOD-1 5'- GCCAATGTGTCCATTGAAGA -3' 5'- CAATCACACCACAAGCCAAG -3' 168
CAT 5' - CACTGACGTCCACCCTGAC -3' 5'- GACTCCATCCAGCGATGATT -3' 242
GPx2 5' - CCTCGCTCTGAGGAACAACT-3' 5'- TGCCCATTGACATCACACTT -3' 220
FAS 5'- AGCTGCTCCAGTGCTGGTAT -3' 5'- CATAGGTGGCAGGCTCTCTC -3' 232
FASL 5'-AGACCACAAGGTCCAACAGG-3' 5'- CAAGTAGACCCACCCTGGAA-3' 244